n1 methylpseudo utp (Jena Bioscience)
Jena Bioscience is a verified supplier 
Jena Bioscience manufactures this product 
94
Structured Review
Jena Bioscience
n1 methylpseudo utp
N1 Methylpseudo Utp, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 94/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n1+methylpseudo+utp/N1-Methylpseudo-UTP/pm41798954-80-31-33
Average 94 stars, based on 25 article reviews
N1 Methylpseudo Utp, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 94/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n1+methylpseudo+utp/N1-Methylpseudo-UTP/pm41798954-80-31-33
Average 94 stars, based on 25 article reviews
n1 methylpseudo utp - by Bioz Stars,
2026-09
94/100 stars
Images
Related Articles
In Vitro:Article Title: mRNA-based SARS-CoV-2 vaccines: intracellular processing and aggregation of the encoded spike protein as a mechanistic contributor to cardiac cellular stress Article Snippet: The template encoded the following components: T7 RNA promoter sequence adapted for use with CleanCap AG (#N-7113, TriLink BioTechnologies, USA) [TAATACGACTCACTATAAGG] – α-globin 5’-untranslated region – firefly luciferase open reading frame – β-globin 3’-untranslated region – segmented polyadenosine tract [60A:G:60A] ( ). .. The in vitro transcription reaction (40 mM Tris-HCl, 10 mM DTT, 2 mM spermidine, 0.002% Triton X-100, 16.5 mM magnesium acetate, 4 mM CleanCap AG, 5 mM ATP, CTP, GTP (#NU-1014L), Article Title: mRNA-based SARS-CoV-2 vaccines: intracellular processing and aggregation of the encoded spike protein as a mechanistic contributor to cardiac cellular stress. Article Snippet: The template encoded the following components: T7 RNA promoter sequence adapted for use with CleanCap AG (#N-7113, TriLink BioTechnologies, USA) [TAATACGACTCACTATAAGG] – a-globin 5’-untranslated region – firefly luciferase open reading frame – b-globin 3’-untranslated region – segmented polyadenosine tract [60A:G:60A] (25). .. The in vitro transcription reaction (40 mM Tris-HCl, 10 mM DTT, 2 mM spermidine, 0.002% Triton X-100, 16.5 mM magnesium acetate, 4 mM CleanCap AG, 5 mM ATP, CTP, GTP (#NU-1014L), Incubation:Article Title: mRNA-based SARS-CoV-2 vaccines: intracellular processing and aggregation of the encoded spike protein as a mechanistic contributor to cardiac cellular stress Article Snippet: The template encoded the following components: T7 RNA promoter sequence adapted for use with CleanCap AG (#N-7113, TriLink BioTechnologies, USA) [TAATACGACTCACTATAAGG] – α-globin 5’-untranslated region – firefly luciferase open reading frame – β-globin 3’-untranslated region – segmented polyadenosine tract [60A:G:60A] ( ). .. The in vitro transcription reaction (40 mM Tris-HCl, 10 mM DTT, 2 mM spermidine, 0.002% Triton X-100, 16.5 mM magnesium acetate, 4 mM CleanCap AG, 5 mM ATP, CTP, GTP (#NU-1014L), Article Title: mRNA-based SARS-CoV-2 vaccines: intracellular processing and aggregation of the encoded spike protein as a mechanistic contributor to cardiac cellular stress. Article Snippet: The template encoded the following components: T7 RNA promoter sequence adapted for use with CleanCap AG (#N-7113, TriLink BioTechnologies, USA) [TAATACGACTCACTATAAGG] – a-globin 5’-untranslated region – firefly luciferase open reading frame – b-globin 3’-untranslated region – segmented polyadenosine tract [60A:G:60A] (25). .. The in vitro transcription reaction (40 mM Tris-HCl, 10 mM DTT, 2 mM spermidine, 0.002% Triton X-100, 16.5 mM magnesium acetate, 4 mM CleanCap AG, 5 mM ATP, CTP, GTP (#NU-1014L), other:Article Title: Inhalable mRNA Nanoparticle with Enhanced Nebulization Stability and Pulmonary Microenvironment Infiltration. Article Snippet: The delivery of mRNA into the lungs is the key to solving infectious and intractable diseases that frequently occur in the lungs.. Since inhalation using a nebulizer is the most promising method for mRNA delivery into the lungs, there have been many attempts toward adapting lipid nanoparticles for mRNA inhalation.. However, conventional lipid nanoparticles, which have shown great effectiveness for systemic delivery of mRNA and intramuscular vaccination, are not effective for pulmonary delivery due to their structural instability during nebulization and their inability to adapt to the pulmonary microenvironment. Article Title: Improvement of Therapeutic Effect via Inducing Non-Apoptotic Cell Death Using mRNA-Protection Nanocage. Article Snippet: Plasmid & Cloning: RIPK3 plasmid constructs were subcloned from pcDNA3-FLAG-RIPK3 (#78 815; Addgene). Immunopeptidomics:Article Title: Improvement of Therapeutic Effect via Inducing Non‐Apoptotic Cell Death Using mRNA‐Protection Nanocage Article Snippet: .. Also, N1‐Methylpseudo‐UTP( In Vivo:Article Title: Lipid Nanoparticles for Broad‐Spectrum Nucleic Acid Delivery Article Snippet: Lipid nanoparticles (LNPs) are the most advanced nonviral modality for nucleic acid (NA) delivery, and have recently gained enormous attention in the fields of RNA therapeutics and vaccine development.. Here, ionizable adamantane-based lipidoids named XMaNs, which circumvent the usual need for laborious optimization of LNP components for highly diverse types of NAs, are described.. The non-toxic XMaN6 lipidoid is highly versatile in entrapment and delivery of siRNA, mRNA, plasmid DNA, and a cyclic dinucleotide. Modification:Article Title: Lipid Nanoparticles for Broad‐Spectrum Nucleic Acid Delivery Article Snippet: Lipid nanoparticles (LNPs) are the most advanced nonviral modality for nucleic acid (NA) delivery, and have recently gained enormous attention in the fields of RNA therapeutics and vaccine development.. Here, ionizable adamantane-based lipidoids named XMaNs, which circumvent the usual need for laborious optimization of LNP components for highly diverse types of NAs, are described.. The non-toxic XMaN6 lipidoid is highly versatile in entrapment and delivery of siRNA, mRNA, plasmid DNA, and a cyclic dinucleotide. |